Changqing Wang
| Snapshot Date: 2026-05-10 13:45 -0400 (Sun, 10 May 2026) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: devel |
| git_last_commit: 38fd4e3 |
| git_last_commit_date: 2026-05-05 04:58:49 -0400 (Tue, 05 May 2026) |
| Back to Build/check report for BioC 3.24: simplified long |
|
This page was generated on 2026-05-11 11:33 -0400 (Mon, 11 May 2026).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 24.04.4 LTS) | x86_64 | 4.6.0 RC (2026-04-17 r89917) -- "Because it was There" | 4890 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 750/2374 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.7.0 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 24.04.4 LTS) / x86_64 | OK | OK | OK | | ||||||||
| See other builds for FLAMES in R Universe. | ||||||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.7.0 |
| Command: /home/biocbuild/bbs-3.24-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.24-bioc/R/site-library --timings FLAMES_2.7.0.tar.gz |
| StartedAt: 2026-05-11 00:04:01 -0400 (Mon, 11 May 2026) |
| EndedAt: 2026-05-11 00:28:11 -0400 (Mon, 11 May 2026) |
| EllapsedTime: 1449.6 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.24-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.24-bioc/R/site-library --timings FLAMES_2.7.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.24-bioc/meat/FLAMES.Rcheck’
* using R version 4.6.0 RC (2026-04-17 r89917)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
gcc (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
* running under: Ubuntu 24.04.4 LTS
* using session charset: UTF-8
* current time: 2026-05-11 04:04:02 UTC
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.7.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable. Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/home/biocbuild/bbs-3.24-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
* checking C++ specification ... INFO
specified C++17
* checking installed package size ... INFO
installed size is 13.3Mb
sub-directories of 1Mb or more:
bin 8.3Mb
data 1.8Mb
libs 1.5Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: ‘scuttle’
All declared Imports should be used.
There are ::: calls to the package's namespace in its code. A package
almost never needs to use ::: for its own objects:
‘gene_quantification’ ‘isoform_identification’ ‘minimap2_align’
‘transcript_quantification’
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
barcode_group: no visible global function definition for ‘new’
barcode_segment: no visible global function definition for ‘new’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
‘chisq.test’
create_sce_from_dir: no visible global function definition for
‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_diversity: no visible global function definition for ‘as’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
‘which_label’
find_variants_grange: no visible binding for global variable
‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘CB’
plot_demultiplex_raw: no visible binding for global variable ‘UB’
plot_demultiplex_raw: no visible binding for global variable
‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable ‘total
reads’
plot_demultiplex_raw: no visible binding for global variable
‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
match reads’
plot_demultiplex_raw: no visible binding for global variable
‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_isoforms: no visible binding for global variable ‘xmin’
plot_isoforms: no visible binding for global variable ‘xmax’
plot_isoforms: no visible binding for global variable ‘ymin’
plot_isoforms: no visible binding for global variable ‘ymax’
plot_isoforms: no visible binding for global variable ‘x’
plot_isoforms: no visible binding for global variable ‘xend’
plot_isoforms: no visible binding for global variable ‘y’
plot_isoforms: no visible binding for global variable ‘yend’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
‘as’
sc_transcript_usage_chisq: no visible binding for global variable
‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘total’
sc_transcript_usage_permutation: no visible binding for global variable
‘test’
sc_transcript_usage_permutation: no visible global function definition
for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
global variable ‘barcodes_files’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
Undefined global functions or variables:
CB Count FSM_match FlankEditDist Freq Reads Sample Type UB UMI_count
adj.p.value allele allele_count as bam_index barcode barcode_rank
barcodes_file barcodes_files capture.output cell_total_reads
chisq.test count counts_no_ins cumpct demultiplexed reads
demultiplexed_fastq download.file duration everything
expect_cell_number expr fastq filter_res genome_bam genotype head
imageX imageY in_tissue input j length_bin max_length min_length
minimap2 multi-matching reads mutation_index n_reads na.omit name new
nucleotide outdir output p.value packageVersion pct pos
read1_with_adapter read_counts ref samtools scale_alpha_continuous
scale_colour_gradient setNames single match reads starts_with step
test threads total total reads total_counts tr_length transcript
transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
value which_label x xend xmax xmin y yend ymax ymin
Consider adding
importFrom("base", "match", "single")
importFrom("methods", "as", "new")
importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
importFrom("utils", "capture.output", "download.file", "head",
"packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
Found ‘abort’, possibly from ‘abort’ (C)
Found ‘exit’, possibly from ‘exit’ (C)
Found ‘stderr’, possibly from ‘stderr’ (C)
Found ‘stdout’, possibly from ‘stdout’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
find_variants 21.973 2.201 23.322
blaze 5.122 17.407 13.363
plot_isoform_reduced_dim 21.468 0.791 22.259
sc_long_multisample_pipeline 8.357 4.968 7.728
bulk_long_pipeline 2.416 10.028 2.603
sc_plot_genotype 10.730 1.674 10.534
MultiSampleSCPipeline 10.280 0.724 11.074
create_sce_from_dir 5.960 3.069 6.862
sc_DTU_analysis 6.621 1.833 6.497
create_se_from_dir 5.297 0.250 5.533
plot_durations 5.090 0.129 5.206
experiment 4.985 0.142 5.113
resume_FLAMES 4.912 0.134 5.033
run_FLAMES 4.899 0.147 5.036
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 4 NOTEs
See
‘/home/biocbuild/bbs-3.24-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.24-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/home/biocbuild/bbs-3.24-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.7.0’
** using non-staged installation via StagedInstall field
** libs
specified C++17
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
233 | if (blocks.size() >= (int)this->Min_sup_cnt) {
| ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
368 | if ((left_counts.size() < (int)this->Min_sup_cnt) ||
| ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
369 | (right_counts.size() < (int)this->Min_sup_cnt)) {
| ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
662 | for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
713 | for (int i = 0; i < new_exons.size(); ++i) {
| ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
725 | } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
| ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
1140 | for (int i = 0; i < exons.size(); i+=2) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
166 | for (int i = 1; i < exons.size(); i++) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:142:56: warning: comparison of integer expressions of different signedness: ‘__gnu_cxx::__alloc_traits<std::allocator<unsigned int>, unsigned int>::value_type’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare]
142 | if (j == (len2 - 1) && dist_holder[i * len2 + j] < best) {
main-functions/flexiplex.cpp: In function ‘void refine_matched_segments(const std::string&, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_set<std::__cxx11::basic_string<char> > >*, const std::vector<int>&, Barcode&, std::vector<int>&, std::vector<int>&)’:
main-functions/flexiplex.cpp:348:70: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
348 | } else if (editDistance < best_edit_distance && editDistance <= s.max_edit_distance) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:30: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
356 | if (best_edit_distance <= s.max_edit_distance && current_segment_unambiguous) {
| ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, BGZF*, bool, bool, bool, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, BarcodeGroup>&)’:
main-functions/flexiplex.cpp:790:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
790 | for (int b = 0; b < vec_size; b++) {
| ~~^~~~~~~~~~
main-functions/flexiplex.cpp:803:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
803 | for (int k = 0; k < vec_size; k++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
87 | while (i < seq.size()) {
| ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
88 | if (i + wrap_len > seq.size()) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’:
main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
268 | for (int i = 0; i < BASES.size(); i++) {
| ~~^~~~~~~~~~~~~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’:
main-functions/pileup_readid.cpp:342:30: required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
86 | unsigned int end;
| ^~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’:
main-functions/pileup_readid.cpp:344:30: required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -std=gnu2x -I"/home/biocbuild/bbs-3.24-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.24-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.24-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.24-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.24-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-g -O2 -Wall -Werror=format-security -Wno-unused-result" minimap2)
make[1]: Entering directory '/home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/submodule/minimap2'
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC main.c -o main.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC kthread.c -o kthread.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC kalloc.c -o kalloc.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC misc.c -o misc.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC bseq.c -o bseq.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC sketch.c -o sketch.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC sdust.c -o sdust.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC options.c -o options.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC index.c -o index.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC lchain.c -o lchain.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC align.c -o align.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC hit.c -o hit.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC seed.c -o seed.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC jump.c -o jump.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC map.c -o map.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC format.c -o format.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC pe.c -o pe.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC esterr.c -o esterr.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC splitidx.c -o splitidx.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse2 -DHAVE_KALLOC ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -g -O2 -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
ar: `u' modifier ignored since `D' is the default (see `U')
cc -g -O2 -Wall -Werror=format-security -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
make[1]: Leaving directory '/home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/submodule/minimap2'
echo "Installing binary to /home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
Updating crates.io index
Installing oarfish v0.8.0
Updating crates.io index
Locking 279 packages to latest compatible versions
Adding generic-array v0.14.7 (available: v0.14.9)
Adding indicatif v0.17.11 (available: v0.18.4)
Adding needletail v0.6.3 (available: v0.7.3)
Adding noodles-bam v0.78.0 (available: v0.89.0)
Adding noodles-bgzf v0.38.0 (available: v0.47.0)
Adding noodles-sam v0.74.0 (available: v0.85.0)
Adding rand v0.9.4 (available: v0.10.1)
Adding tabled v0.18.0 (available: v0.20.0)
Adding typed-builder v0.21.2 (available: v0.23.2)
Compiling libc v0.2.186
Compiling proc-macro2 v1.0.106
Compiling quote v1.0.45
Compiling unicode-ident v1.0.24
Compiling find-msvc-tools v0.1.9
Compiling shlex v1.3.0
Compiling cfg-if v1.0.4
Compiling autocfg v1.5.0
Compiling pkg-config v0.3.33
Compiling libm v0.2.16
Compiling memchr v2.8.0
Compiling zerocopy v0.8.48
Compiling crossbeam-utils v0.8.21
Compiling version_check v0.9.5
Compiling adler2 v2.0.1
Compiling simd-adler32 v0.3.9
Compiling crc32fast v1.5.0
Compiling once_cell v1.21.4
Compiling regex-syntax v0.8.10
Compiling serde_core v1.0.228
Compiling pin-project-lite v0.2.17
Compiling zlib-rs v0.6.3
Compiling rawpointer v0.2.1
Compiling hashbrown v0.17.1
Compiling futures-core v0.3.32
Compiling typenum v1.20.0
Compiling equivalent v1.0.2
Compiling getrandom v0.3.4
Compiling either v1.15.0
Compiling paste v1.0.15
Compiling serde v1.0.228
Compiling futures-sink v0.3.32
Compiling lexical-util v1.0.7
Compiling slab v0.4.12
Compiling heck v0.5.0
Compiling futures-task v0.3.32
Compiling futures-io v0.3.32
Compiling zstd-safe v7.2.4
Compiling vcpkg v0.2.15
Compiling bitflags v2.11.1
Compiling bytecount v0.6.9
Compiling zstd-safe v6.0.6
Compiling anyhow v1.0.102
Compiling rustversion v1.0.22
Compiling rustix v1.1.4
Compiling lazy_static v1.5.0
Compiling utf8parse v0.2.2
Compiling byteorder v1.5.0
Compiling getrandom v0.4.2
Compiling semver v1.0.28
Compiling snap v1.1.1
Compiling bytes v1.11.1
Compiling rayon-core v1.13.0
Compiling itoa v1.0.18
Compiling zmij v1.0.21
Compiling unicode-width v0.2.2
Compiling static_assertions v1.1.0
Compiling serde_json v1.0.149
Compiling array-init-cursor v0.2.1
Compiling smallvec v1.15.1
Compiling is_terminal_polyfill v1.70.2
Compiling linux-raw-sys v0.12.1
Compiling thiserror v1.0.69
Compiling log v0.4.29
Compiling anstyle v1.0.14
Compiling fallible-streaming-iterator v0.1.9
Compiling portable-atomic v1.13.1
Compiling anstyle-query v1.1.5
Compiling bit-vec v0.8.0
Compiling colorchoice v1.0.5
Compiling fnv v1.0.7
Compiling fastrand v2.4.1
Compiling num-traits v0.2.19
Compiling miniz_oxide v0.8.9
Compiling matrixmultiply v0.3.10
Compiling futures-channel v0.3.32
Compiling num-complex v0.2.4
Compiling tracing-core v0.1.36
Compiling anstyle-parse v1.0.0
Compiling sharded-slab v0.1.7
Compiling twox-hash v1.6.3
Compiling thread_local v1.1.9
Compiling itertools v0.13.0
Compiling planus v0.3.1
Compiling seq-macro v0.3.6
Compiling nu-ansi-term v0.50.3
Compiling cpufeatures v0.2.17
Compiling clap_lex v1.1.0
Compiling strsim v0.11.1
Compiling itertools v0.14.0
Compiling generic-array v0.14.7
Compiling ahash v0.8.12
Compiling rustc_version v0.4.1
Compiling streaming-decompression v0.1.2
Compiling simdutf8 v0.1.5
Compiling number_prefix v0.4.0
Compiling arrayvec v0.7.6
Compiling base64 v0.22.1
Compiling ethnum v1.5.3
Compiling streaming-iterator v0.1.9
Compiling ryu v1.0.23
Compiling hash_hasher v2.0.4
Compiling dyn-clone v1.0.20
Compiling foreign_vec v0.1.0
Compiling aho-corasick v1.1.4
Compiling lexical-parse-integer v1.0.6
Compiling lexical-write-integer v1.0.6
Compiling buffer-redux v1.1.0
Compiling anstream v1.0.0
Compiling csv-core v0.1.13
Compiling papergrid v0.14.0
Compiling base64 v0.21.7
Compiling hex v0.4.3
Compiling atomic_float v1.1.0
Compiling parse-size v1.1.0
Compiling path-tools v0.1.0
Compiling rustc-hash v2.1.2
Compiling lz4_flex v0.10.0
Compiling indexmap v2.14.0
Compiling num-format v0.4.4
Compiling tracing-log v0.2.0
Compiling lexical-parse-float v1.0.6
Compiling arrow2 v0.18.0
Compiling crossbeam-channel v0.5.15
Compiling crossbeam-epoch v0.9.18
Compiling crossbeam-queue v0.3.12
Compiling clap_builder v4.6.0
Compiling lexical-write-float v1.0.6
Compiling crossbeam-deque v0.8.6
Compiling syn v2.0.117
Compiling proc-macro-error-attr2 v2.0.0
Compiling lexical-core v1.0.6
Compiling block-buffer v0.10.4
Compiling crypto-common v0.1.7
Compiling crossbeam v0.8.4
Compiling jobserver v0.1.34
Compiling digest v0.10.7
Compiling cc v1.2.62
Compiling getrandom v0.2.17
Compiling console v0.15.11
Compiling num_cpus v1.17.0
Compiling rayon v1.12.0
Compiling rand_core v0.9.5
Compiling rand_core v0.6.4
Compiling regex-automata v0.4.14
Compiling flate2 v1.1.9
Compiling indicatif v0.17.11
Compiling num-integer v0.1.46
Compiling num-complex v0.4.6
Compiling approx v0.5.1
Compiling approx v0.3.2
Compiling noisy_float v0.2.1
Compiling chrono v0.4.44
Compiling tempfile v3.27.0
Compiling num-bigint v0.4.6
Compiling num-iter v0.1.45
Compiling noodles-bgzf v0.38.0
Compiling zstd-sys v2.0.16+zstd.1.5.7
Compiling liblzma-sys v0.3.13
Compiling bzip2-sys v0.1.13+1.0.8
Compiling libz-sys v1.1.28
Compiling sha2-asm v0.6.4
Compiling minimap2-sys v0.1.30+minimap2.2.30
Compiling lz4-sys v1.11.1+lz4-1.10.0
Compiling ndarray v0.16.1
Compiling ndarray v0.17.2
Compiling ndarray v0.15.6
Compiling alga v0.9.3
Compiling sha2 v0.10.9
Compiling csv v1.4.0
Compiling num-rational v0.4.2
Compiling liblzma v0.3.6
Compiling num v0.4.3
Compiling proc-macro-error2 v2.0.1
Compiling bytemuck_derive v1.10.2
Compiling futures-macro v0.3.32
Compiling serde_derive v1.0.228
Compiling async-trait v0.1.89
Compiling tracing-attributes v0.1.31
Compiling async-stream-impl v0.3.6
Compiling thiserror-impl v1.0.69
Compiling derive-new v0.6.0
Compiling clap_derive v4.6.1
Compiling tabled_derive v0.10.0
Compiling strum_macros v0.26.4
Compiling typed-builder-macro v0.21.2
Compiling async-stream v0.3.6
Compiling futures-util v0.3.32
Compiling ppv-lite86 v0.2.21
Compiling tabled v0.18.0
Compiling hashbrown v0.14.5
Compiling bstr v1.12.1
Compiling matchers v0.2.0
Compiling regex v1.12.3
Compiling tracing v0.1.44
Compiling bytemuck v1.25.0
Compiling rand_chacha v0.3.1
Compiling rand_chacha v0.9.0
Compiling bzip2 v0.4.4
Compiling tracing-subscriber v0.3.23
Compiling safe_arch v0.7.4
Compiling rand v0.8.6
Compiling rand v0.9.4
Compiling typed-builder v0.21.2
Compiling noodles-core v0.17.0
Compiling wide v0.7.33
Compiling noodles-csi v0.46.0
Compiling clap v4.6.1
Compiling rand_distr v0.4.3
Compiling noodles-sam v0.74.0
Compiling ndarray-stats v0.6.0
Compiling kders v0.1.1
Compiling simba v0.9.1
Compiling arrow-format v0.8.1
Compiling bincode v1.3.3
Compiling bio-types v1.0.4
Compiling noodles-bam v0.78.0
Compiling futures-executor v0.3.32
Compiling futures v0.3.32
Compiling parquet-format-safe v0.2.4
Compiling sendable-swapvec v0.4.3
Compiling sprs v0.11.4
Compiling lz4 v1.28.1
Compiling nalgebra v0.33.3
Compiling zstd v0.12.4
Compiling zstd v0.13.3
Compiling parquet2 v0.17.2
Compiling needletail v0.6.3
Compiling seqcol_rs v0.4.1
Compiling minimap2 v0.1.31+minimap2.2.30
Compiling statrs v0.18.0
Compiling oarfish v0.8.0
Finished `release` profile [optimized] target(s) in 54.13s
Installing /home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/cargo_temp/bin/oarfish
Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `/home/biocbuild/bbs-3.24-bioc/meat/FLAMES/src/cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f748cfb253/config_file_3215220.json
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f748cfb253/config_file_3215220.json
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f748cfb253/config_file_3215220.json
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7461743d30/config_file_3215220.json
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f742cd505b6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74231f8223/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74231f8223/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f744b9dfd69/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f744b9dfd69/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f744b9dfd69/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f744b9dfd69/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74696c2d9c/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
Skipping TSO trimming...
2 transcripts found in the BAM file.
1(50%) transcripts failed the filter.
Failed transcripts account for 100 reads, out of 200(50%) reads in total.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74f21cb6a/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:13:25 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Mon May 11 00:13:27 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:13:58 2026 -------------------
Realigning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample1_realign2transcript.bam
Skipped sorting BAM files.
Realigning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample2_realign2transcript.bam
Skipped sorting BAM files.
Realigning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample3_realign2transcript.bam
Skipped sorting BAM files.
-- Running step: transcript_quantification @ Mon May 11 00:13:59 2026 ----------
[2m2026-05-11T04:13:59.111476Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:13:59.111955Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:13:59.111967Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:13:59.111971Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:13:59.112038Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:13:59.112044Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:13:59.116102Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 1 unmapped read records.
[2m2026-05-11T04:13:59.116307Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 686 │
│ aligned fraction too low │ 16 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 4 │
│ reads with valid best alignment │ 283 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:13:59.116329Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 364
[2m2026-05-11T04:13:59.116331Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 283
[2m2026-05-11T04:13:59.116333Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 235
[2m2026-05-11T04:13:59.117160Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:13:59.124311Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:13:59.124751Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:13:59.124764Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:13:59.124767Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:13:59.124822Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:13:59.124827Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:13:59.128895Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 1 unmapped read records.
[2m2026-05-11T04:13:59.129089Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 695 │
│ aligned fraction too low │ 14 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 7 │
│ reads with valid best alignment │ 285 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:13:59.129118Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 369
[2m2026-05-11T04:13:59.129121Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 285
[2m2026-05-11T04:13:59.129123Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 235
[2m2026-05-11T04:13:59.129958Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:13:59.136804Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:13:59.137232Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74f21cb6a/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:13:59.137241Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:13:59.137244Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:13:59.137301Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:13:59.137306Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:13:59.141352Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-05-11T04:13:59.141544Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 696 │
│ aligned fraction too low │ 14 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 5 │
│ reads with valid best alignment │ 284 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:13:59.141579Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 362
[2m2026-05-11T04:13:59.141582Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 284
[2m2026-05-11T04:13:59.141585Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 237
[2m2026-05-11T04:13:59.142395Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f743cfd0aab/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:13:59 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample1_align2genome.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample2_align2genome.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample3_align2genome.bam
-- Running step: isoform_identification @ Mon May 11 00:14:21 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:14:43 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f743cfd0aab/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:15:04 2026 ----------
[2m2026-05-11T04:15:04.811820Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:15:04.812441Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743cfd0aab/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:15:04.812456Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:15:04.812460Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:15:04.812536Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:15:04.812544Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:15:04.816580Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-05-11T04:15:04.816784Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 702 │
│ aligned fraction too low │ 13 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 5 │
│ reads with valid best alignment │ 285 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:15:04.816807Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 364
[2m2026-05-11T04:15:04.816811Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 285
[2m2026-05-11T04:15:04.816813Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 238
[2m2026-05-11T04:15:04.817619Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:15:04.828548Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:15:04.828908Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743cfd0aab/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:15:04.828918Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:15:04.828923Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:15:04.828989Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:15:04.828994Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:15:04.832848Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-05-11T04:15:04.833038Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 687 │
│ aligned fraction too low │ 16 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 6 │
│ reads with valid best alignment │ 282 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:15:04.833059Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 355
[2m2026-05-11T04:15:04.833062Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 282
[2m2026-05-11T04:15:04.833064Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 240
[2m2026-05-11T04:15:04.833869Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:15:04.844567Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:15:04.845038Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743cfd0aab/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:15:04.845048Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:15:04.845051Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:15:04.845117Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:15:04.845122Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:15:04.849055Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-05-11T04:15:04.849239Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 688 │
│ aligned fraction too low │ 15 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 7 │
│ reads with valid best alignment │ 283 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:15:04.849261Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 354
[2m2026-05-11T04:15:04.849263Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 283
[2m2026-05-11T04:15:04.849265Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 240
[2m2026-05-11T04:15:04.850104Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74bee12fc/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:15:05 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Mon May 11 00:15:07 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:15:27 2026 -------------------
Realigning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74bee12fc/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:15:28 2026 ----------
00:15:28 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7412dae960/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:15:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample1_align2genome.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample2_align2genome.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample3_align2genome.bam
-- Running step: isoform_identification @ Mon May 11 00:15:51 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 5 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:16:11 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f7412dae960/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:16:32 2026 ----------
00:16:32 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Inputs: ['/tmp/Rtmpzwpfa1/file310f74bee12fc/sample1_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74bee12fc/sample2_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74bee12fc/sample3_realign2transcript.bam'] /tmp/Rtmpzwpfa1/file310f74bee12fc/transcript_assembly.fa.fai 5 0.4 0.4
Counter({'counted_reads': 866, 'not_enough_coverage': 30, 'unmapped': 4})
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74542b1946/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:16:33 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Mon May 11 00:16:35 2026 -------------
Inputs: ['/tmp/Rtmpzwpfa1/file310f7412dae960/sample1_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f7412dae960/sample2_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f7412dae960/sample3_realign2transcript.bam'] /tmp/Rtmpzwpfa1/file310f7412dae960/transcript_assembly.fa.fai 5 0.4 0.4
Counter({'counted_reads': 863, 'not_enough_coverage': 32, 'unmapped': 5})
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:16:35 2026 -------------------
Realigning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample1_realign2transcript.bam
Skipped sorting BAM files.
Realigning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample2_realign2transcript.bam
Skipped sorting BAM files.
Realigning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74542b1946/sample3_realign2transcript.bam
Skipped sorting BAM files.
-- Running step: transcript_quantification @ Mon May 11 00:16:38 2026 ----------
[2m2026-05-11T04:16:38.693440Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:16:38.693957Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74542b1946/sample1_realign2transcript.bam, contains 17 reference sequences.
[2m2026-05-11T04:16:38.693967Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:16:38.693970Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:16:38.694062Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:16:38.694071Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-05-11T04:16:38.704663Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:16:38.704865Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 3436 │
│ aligned fraction too low │ 7 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 293 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:16:38.704895Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 513
[2m2026-05-11T04:16:38.704898Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 293
[2m2026-05-11T04:16:38.704900Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 198
[2m2026-05-11T04:16:38.705793Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:16:38.713988Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:16:38.714453Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74542b1946/sample2_realign2transcript.bam, contains 17 reference sequences.
[2m2026-05-11T04:16:38.714466Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:16:38.714469Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:16:38.714559Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:16:38.714568Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-05-11T04:16:38.724762Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:16:38.724961Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 3402 │
│ aligned fraction too low │ 8 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 292 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:16:38.725004Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 525
[2m2026-05-11T04:16:38.725006Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 292
[2m2026-05-11T04:16:38.725008Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 190
[2m2026-05-11T04:16:38.725904Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:16:38.733033Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:16:38.733477Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74542b1946/sample3_realign2transcript.bam, contains 17 reference sequences.
[2m2026-05-11T04:16:38.733488Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:16:38.733491Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:16:38.733570Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:16:38.733578Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-05-11T04:16:38.743752Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:16:38.743958Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 3342 │
│ aligned fraction too low │ 10 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 290 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:16:38.743987Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 517
[2m2026-05-11T04:16:38.743990Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 290
[2m2026-05-11T04:16:38.743992Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 192
[2m2026-05-11T04:16:38.744866Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74daeff7e/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:16:38 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample1_align2genome.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample2_align2genome.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample3_align2genome.bam
-- Running step: isoform_identification @ Mon May 11 00:17:00 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:17:00 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f74daeff7e/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:17:21 2026 ----------
[2m2026-05-11T04:17:21.413199Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:17:21.413622Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74daeff7e/sample1_realign2transcript.bam, contains 15 reference sequences.
[2m2026-05-11T04:17:21.413634Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:17:21.413637Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:17:21.413719Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:17:21.413729Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-05-11T04:17:21.423075Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:17:21.423309Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 3045 │
│ aligned fraction too low │ 7 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 293 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:17:21.423343Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 495
[2m2026-05-11T04:17:21.423347Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 293
[2m2026-05-11T04:17:21.423350Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 208
[2m2026-05-11T04:17:21.424258Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:17:21.436018Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:17:21.436475Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74daeff7e/sample2_realign2transcript.bam, contains 15 reference sequences.
[2m2026-05-11T04:17:21.436487Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:17:21.436491Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:17:21.436572Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:17:21.436594Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-05-11T04:17:21.445782Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:17:21.445992Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 2896 │
│ aligned fraction too low │ 10 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 290 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:17:21.446027Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 511
[2m2026-05-11T04:17:21.446029Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 290
[2m2026-05-11T04:17:21.446032Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 198
[2m2026-05-11T04:17:21.446906Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-05-11T04:17:21.454247Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:17:21.454609Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74daeff7e/sample3_realign2transcript.bam, contains 15 reference sequences.
[2m2026-05-11T04:17:21.454620Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:17:21.454622Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:17:21.454700Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:17:21.454708Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-05-11T04:17:21.463792Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-05-11T04:17:21.464005Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 2880 │
│ aligned fraction too low │ 9 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 291 │
╰─────────────────────────────────┴───────╯
[2m2026-05-11T04:17:21.464035Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 496
[2m2026-05-11T04:17:21.464037Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 291
[2m2026-05-11T04:17:21.464040Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 206
[2m2026-05-11T04:17:21.464927Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74e8983ae/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:17:21 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Mon May 11 00:17:23 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:17:23 2026 -------------------
Realigning sample sample1 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample2 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample3 -> /tmp/Rtmpzwpfa1/file310f74e8983ae/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:17:25 2026 ----------
00:17:25 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74347dfbb8/config_file_3215220.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Mon May 11 00:17:26 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample1_align2genome.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample2_align2genome.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample3_align2genome.bam
-- Running step: isoform_identification @ Mon May 11 00:17:46 2026 -------------
Inputs: ['/tmp/Rtmpzwpfa1/file310f74e8983ae/sample1_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74e8983ae/sample2_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74e8983ae/sample3_realign2transcript.bam'] /tmp/Rtmpzwpfa1/file310f74e8983ae/transcript_assembly.fa.fai 5 0.4 0.4
Counter({'counted_reads': 895, 'not_enough_coverage': 5})
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:17:46 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:18:07 2026 ----------
00:18:07 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Inputs: ['/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample1_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample2_realign2transcript.bam', '/tmp/Rtmpzwpfa1/file310f74347dfbb8/sample3_realign2transcript.bam'] /tmp/Rtmpzwpfa1/file310f74347dfbb8/transcript_assembly.fa.fai 5 0.4 0.4
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7451deeaba/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:18:08 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7451deeaba/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:18:08 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f7451deeaba/matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7451deeaba/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:18:09 2026 ----------------
00:18:09 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f7451deeaba/align2genome.bam'
Counter({'counted_reads': 895, 'not_enough_coverage': 5})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.76gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.75gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 425334.04Read/s]
-- Running step: isoform_identification @ Mon May 11 00:18:10 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:18:19 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7451deeaba/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7451deeaba/matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f7451deeaba/matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7451deeaba/realign2transcript.bam
Sorting BAM files by 8 with CB threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Mon May 11 00:18:19 2026 ----------
[2m2026-05-11T04:18:19.709888Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:18:19.710295Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f7451deeaba/realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:18:19.710320Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:18:19.710323Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:18:19.710382Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:18:19.710389Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:18:19.716629Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7436f7454d/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:18:20 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7436f7454d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:18:20 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f7436f7454d/matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f7436f7454d/align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:18:43 2026 ----------------
00:18:43 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f7436f7454d/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.76gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.75gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 438441.21Read/s]
-- Running step: isoform_identification @ Mon May 11 00:18:44 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:18:53 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7436f7454d/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7436f7454d/matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f7436f7454d/matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f7436f7454d/realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:19:11 2026 ----------
[2m2026-05-11T04:19:11.156881Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:19:11.157410Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f7436f7454d/realign2transcript.bam, contains 5 reference sequences.
[2m2026-05-11T04:19:11.157422Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:19:11.157426Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:19:11.157485Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:19:11.157491Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-05-11T04:19:11.163822Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7479031d0c/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:19:11 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7479031d0c/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:19:11 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f7479031d0c/matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7479031d0c/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:19:12 2026 ----------------
00:19:12 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f7479031d0c/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.69gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 372787.26Read/s]
-- Running step: isoform_identification @ Mon May 11 00:19:12 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:19:22 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7479031d0c/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7479031d0c/matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f7479031d0c/matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7479031d0c/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:19:22 2026 ----------
00:19:22 Mon May 11 2026 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f747d4eef89/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:19:23 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f747d4eef89/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:19:23 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f747d4eef89/matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f747d4eef89/align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:19:43 2026 ----------------
00:19:43 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f747d4eef89/align2genome.bam'
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.81gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.81gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 419984.78Read/s]
-- Running step: isoform_identification @ Mon May 11 00:19:44 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:19:53 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f747d4eef89/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f747d4eef89/matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f747d4eef89/matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f747d4eef89/realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:20:13 2026 ----------
00:20:13 Mon May 11 2026 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74427b4d91/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:20:14 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74427b4d91/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:20:14 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f74427b4d91/matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74427b4d91/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:20:14 2026 ----------------
00:20:14 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f74427b4d91/align2genome.bam'
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.67gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.66gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 337151.86Read/s]
-- Running step: isoform_identification @ Mon May 11 00:20:15 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:20:15 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f74427b4d91/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f74427b4d91/matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f74427b4d91/matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74427b4d91/realign2transcript.bam
Sorting BAM files by 8 with CB threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Mon May 11 00:20:16 2026 ----------
[2m2026-05-11T04:20:16.198600Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:20:16.199115Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74427b4d91/realign2transcript.bam, contains 10 reference sequences.
[2m2026-05-11T04:20:16.199124Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:20:16.199128Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:20:16.199207Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:20:16.199214Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2026-05-11T04:20:16.209227Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f744fa0b2ed/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:20:16 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f744fa0b2ed/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:20:17 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f744fa0b2ed/matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744fa0b2ed/align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:20:36 2026 ----------------
00:20:36 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f744fa0b2ed/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.68gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.68gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 371453.47Read/s]
-- Running step: isoform_identification @ Mon May 11 00:20:37 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:20:37 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f744fa0b2ed/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f744fa0b2ed/matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f744fa0b2ed/matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744fa0b2ed/realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:20:57 2026 ----------
[2m2026-05-11T04:20:57.499340Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:20:57.499817Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f744fa0b2ed/realign2transcript.bam, contains 10 reference sequences.
[2m2026-05-11T04:20:57.499840Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:20:57.499844Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:20:57.499910Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:20:57.499918Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2026-05-11T04:20:57.510878Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f745564d072/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:20:58 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745564d072/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:20:58 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f745564d072/matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745564d072/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:20:58 2026 ----------------
00:20:58 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f745564d072/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.66gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.65gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 350647.41Read/s]
-- Running step: isoform_identification @ Mon May 11 00:20:59 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:20:59 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745564d072/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745564d072/matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f745564d072/matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745564d072/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:21:00 2026 ----------
00:21:00 Mon May 11 2026 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f747fe13f32/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:21:01 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f747fe13f32/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:21:01 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f747fe13f32/matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f747fe13f32/align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:21:20 2026 ----------------
00:21:20 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f747fe13f32/align2genome.bam'
Counter({'counted_reads': 358})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.85gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.84gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 350788.17Read/s]
-- Running step: isoform_identification @ Mon May 11 00:21:20 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:21:21 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f747fe13f32/matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f747fe13f32/matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f747fe13f32/matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f747fe13f32/realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:21:39 2026 ----------
00:21:39 Mon May 11 2026 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f745aaa8d61/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:21:40 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aaa8d61/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 927
Number of chimera reads: 3
All done!
Reads Barcodes
26 1
23 3
22 1
21 3
20 1
19 1
18 1
16 2
15 1
14 2
13 3
12 5
11 2
10 6
9 9
8 3
7 6
6 11
5 8
4 8
3 39
2 19
1 2
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aaa8d61/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 1
7 5
6 2
5 7
4 5
3 19
2 27
1 53
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aaa8d61/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
7 5
6 4
5 1
4 15
3 12
2 23
1 65
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aaa8d61/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:21:42 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:21:45 2026 ----------------
00:21:45 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_align2genome.bam'
Counter({'counted_reads': 358})
parsing /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.18gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 163986.05Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.99gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 535342.83Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.92gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 590747.04Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 8.30gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 8.29gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 386557.55Read/s]
-- Running step: isoform_identification @ Mon May 11 00:21:46 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 7 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:22:10 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq, /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
-- Running step: transcript_quantification @ Mon May 11 00:22:12 2026 ----------
[2m2026-05-11T04:22:12.323418Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:22:12.323824Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f745aaa8d61/sampleA_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:22:12.323834Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:22:12.323838Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:22:12.323904Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:22:12.323911Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:22:12.334993Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:22:12.682753Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:22:12.683239Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample1_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:22:12.683248Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:22:12.683251Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:22:12.683308Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:22:12.683314Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:22:12.688707Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:22:13.001129Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:22:13.001520Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample2_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:22:13.001531Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:22:13.001535Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:22:13.001595Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:22:13.001601Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:22:13.006784Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:22:13.336731Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:22:13.337231Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f745aaa8d61/sample3_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:22:13.337239Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:22:13.337242Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:22:13.337312Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:22:13.337317Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:22:13.343174Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f743364a16/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:22:13 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f743364a16/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 930
Number of chimera reads: 3
All done!
Reads Barcodes
28 1
25 1
23 3
22 1
21 1
19 2
18 1
17 1
16 2
15 2
14 2
13 4
12 2
11 5
10 4
9 7
8 7
7 2
6 11
5 12
4 7
3 37
2 20
1 2
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f743364a16/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads Barcodes
10 1
9 1
8 3
7 2
6 4
5 7
4 6
3 15
2 21
1 60
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f743364a16/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads Barcodes
8 2
7 3
6 1
5 6
4 9
3 19
2 29
1 56
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f743364a16/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:22:15 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f743364a16/sampleA_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sampleA_align2genome.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample1_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample1_align2genome.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample2_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample2_align2genome.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample3_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample3_align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:22:36 2026 ----------------
00:22:36 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f743364a16/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f743364a16/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f743364a16/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f743364a16/sample3_align2genome.bam'
parsing /tmp/Rtmpzwpfa1/file310f743364a16/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.85gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 153453.14Read/s]
parsing /tmp/Rtmpzwpfa1/file310f743364a16/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 451388.72Read/s]
parsing /tmp/Rtmpzwpfa1/file310f743364a16/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 25.67gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 495312.23Read/s]
parsing /tmp/Rtmpzwpfa1/file310f743364a16/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.66gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 334997.60Read/s]
-- Running step: isoform_identification @ Mon May 11 00:22:37 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:23:01 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f743364a16/fastq, /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f743364a16/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f743364a16/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f743364a16/sample3_matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f743364a16/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sampleA_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample1_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample2_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f743364a16/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f743364a16/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:23:22 2026 ----------
[2m2026-05-11T04:23:22.417998Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:23:22.418400Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743364a16/sampleA_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:23:22.418412Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:23:22.418416Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:23:22.418478Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:23:22.418486Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:23:22.429814Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:23:22.792794Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:23:22.793264Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743364a16/sample1_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:23:22.793275Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:23:22.793279Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:23:22.793339Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:23:22.793346Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:23:22.798595Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:23:23.127861Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:23:23.128409Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743364a16/sample2_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:23:23.128423Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:23:23.128427Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:23:23.128499Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:23:23.128507Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:23:23.133789Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:23:23.485428Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:23:23.485909Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f743364a16/sample3_realign2transcript.bam, contains 6 reference sequences.
[2m2026-05-11T04:23:23.485919Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:23:23.485923Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:23:23.485988Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:23:23.485994Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-05-11T04:23:23.492017Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7441d405b/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:23:24 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7441d405b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads Barcodes
27 1
26 1
24 1
22 2
21 1
20 3
19 1
18 1
17 2
16 2
15 2
14 1
12 1
11 7
10 5
9 5
8 9
7 5
6 13
5 11
4 5
3 33
2 22
1 3
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7441d405b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 3
7 2
6 5
5 3
4 9
3 13
2 31
1 55
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7441d405b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads Barcodes
9 1
8 3
7 1
6 5
5 5
4 6
3 18
2 30
1 50
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7441d405b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:23:25 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:23:28 2026 ----------------
00:23:28 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f7441d405b/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f7441d405b/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f7441d405b/sample3_align2genome.bam'
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.43gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 162355.97Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 19.71gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 513403.84Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.57gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 469665.86Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 426493.13Read/s]
-- Running step: isoform_identification @ Mon May 11 00:23:30 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:23:58 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7441d405b/fastq, /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:23:59 2026 ----------
00:23:59 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7441d405b/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7441d405b/sample1_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7441d405b/sample2_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7441d405b/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7441d405b/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f745aeb7806/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:24:02 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aeb7806/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 924
Number of chimera reads: 2
All done!
Reads Barcodes
26 1
25 1
22 1
21 3
20 2
19 2
18 1
17 4
16 1
15 1
14 1
13 1
12 1
11 7
10 5
9 3
8 11
7 3
6 5
5 19
4 7
3 35
2 19
1 3
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aeb7806/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 1
7 3
6 5
5 8
4 7
3 11
2 23
1 66
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aeb7806/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 277
Number of chimera reads: 0
All done!
Reads Barcodes
8 1
7 3
6 8
5 5
4 4
3 19
2 22
1 60
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745aeb7806/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:24:03 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:24:24 2026 ----------------
00:24:24 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_align2genome.bam'
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
Counter({'counted_reads': 262, 'not_enough_coverage': 8, 'unmapped': 2})
Counter({'counted_reads': 264, 'not_enough_coverage': 8, 'unmapped': 1})
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 12.82gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
/home/biocbuild/bbs-3.24-bioc/R/site-library/FLAMES/python/count_gene.py:704: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
plt.figure(figsize=(8, 6))
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 132875.79Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 19.29gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 482325.67Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 5.83gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 5.82gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 481594.64Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.55gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 370862.28Read/s]
-- Running step: isoform_identification @ Mon May 11 00:24:26 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Mon May 11 00:24:49 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq, /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:25:09 2026 ----------
00:25:09 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745aeb7806/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745aeb7806/sample1_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745aeb7806/sample2_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745aeb7806/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:25:11 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74bf5b8b2/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads Barcodes
28 1
26 1
21 2
20 3
19 4
17 2
14 4
13 2
12 5
11 7
10 1
9 6
8 4
7 7
6 12
5 15
4 4
3 35
2 19
1 3
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74bf5b8b2/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 1
7 4
6 3
5 5
4 8
3 12
2 36
1 54
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74bf5b8b2/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 0
All done!
Reads Barcodes
9 2
7 1
6 4
5 8
4 14
3 9
2 27
1 59
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f74bf5b8b2/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:25:13 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:25:16 2026 ----------------
00:25:16 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_align2genome.bam'
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
Counter({'counted_reads': 265, 'not_enough_coverage': 8, 'unmapped': 2})
Counter({'counted_reads': 261, 'not_enough_coverage': 9, 'unmapped': 1})
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.44gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 167253.01Read/s]
parsing /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.26gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 542544.63Read/s]
parsing /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 25.85gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 513756.00Read/s]
parsing /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.29gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 410385.50Read/s]
-- Running step: isoform_identification @ Mon May 11 00:25:17 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:25:18 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
Realigning sample /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...
-- Running step: transcript_quantification @ Mon May 11 00:25:25 2026 ----------
[2m2026-05-11T04:25:25.813347Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:25:25.813864Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sampleA_realign2transcript.bam, contains 27 reference sequences.
[2m2026-05-11T04:25:25.813878Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:25:25.813881Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:25:25.814008Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:25:25.814021Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-05-11T04:25:25.856110Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:25:26.389082Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:25:26.389818Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample1_realign2transcript.bam, contains 27 reference sequences.
[2m2026-05-11T04:25:26.389833Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:25:26.389836Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:25:26.389964Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:25:26.389977Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-05-11T04:25:26.405647Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:25:27.003617Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:25:27.004164Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample2_realign2transcript.bam, contains 27 reference sequences.
[2m2026-05-11T04:25:27.004174Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:25:27.004177Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:25:27.004302Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:25:27.004315Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-05-11T04:25:27.020800Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:25:27.577788Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:25:27.578192Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f74bf5b8b2/sample3_realign2transcript.bam, contains 27 reference sequences.
[2m2026-05-11T04:25:27.578203Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:25:27.578206Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:25:27.578328Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:25:27.578340Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-05-11T04:25:27.596312Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f744c14f214/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:25:28 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f744c14f214/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 932
Number of chimera reads: 3
All done!
Reads Barcodes
26 1
25 1
24 1
22 2
21 1
20 4
19 1
18 1
15 3
14 1
13 1
12 3
11 9
10 5
9 5
8 6
7 3
6 15
5 10
4 6
3 37
2 20
1 1
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f744c14f214/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads Barcodes
8 2
7 4
6 5
5 2
4 9
3 18
2 27
1 56
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f744c14f214/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads Barcodes
8 3
7 4
6 4
5 3
4 9
3 17
2 26
1 58
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f744c14f214/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:25:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_align2genome.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample1_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample1_align2genome.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample2_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample2_align2genome.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample3_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample3_align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:25:51 2026 ----------------
00:25:51 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f744c14f214/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f744c14f214/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f744c14f214/sample3_align2genome.bam'
parsing /tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.21gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 147059.17Read/s]
parsing /tmp/Rtmpzwpfa1/file310f744c14f214/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 26.68gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 495569.73Read/s]
parsing /tmp/Rtmpzwpfa1/file310f744c14f214/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.86gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 444537.90Read/s]
parsing /tmp/Rtmpzwpfa1/file310f744c14f214/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.88gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 366981.42Read/s]
-- Running step: isoform_identification @ Mon May 11 00:25:52 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:25:53 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f744c14f214/fastq, /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f744c14f214/sample3_matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample1_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample2_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f744c14f214/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f744c14f214/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:26:19 2026 ----------
[2m2026-05-11T04:26:19.222652Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:26:19.223080Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f744c14f214/sampleA_realign2transcript.bam, contains 28 reference sequences.
[2m2026-05-11T04:26:19.223093Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:26:19.223098Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:26:19.223247Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:26:19.223261Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-05-11T04:26:19.264871Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:26:19.964346Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:26:19.964798Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f744c14f214/sample1_realign2transcript.bam, contains 28 reference sequences.
[2m2026-05-11T04:26:19.964812Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:26:19.964815Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:26:19.964964Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:26:19.964977Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-05-11T04:26:19.980466Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:26:20.552097Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:26:20.552625Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f744c14f214/sample2_realign2transcript.bam, contains 28 reference sequences.
[2m2026-05-11T04:26:20.552639Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:26:20.552643Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:26:20.552769Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:26:20.552784Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-05-11T04:26:20.569365Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-05-11T04:26:21.124961Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-05-11T04:26:21.125557Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmpzwpfa1/file310f744c14f214/sample3_realign2transcript.bam, contains 28 reference sequences.
[2m2026-05-11T04:26:21.125570Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-05-11T04:26:21.125574Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-05-11T04:26:21.125701Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-05-11T04:26:21.125715Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-05-11T04:26:21.144456Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f7454ce646/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:26:21 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7454ce646/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads Barcodes
26 1
23 2
22 1
21 1
20 2
19 2
18 4
16 2
15 1
14 1
13 1
12 5
11 6
10 5
9 4
8 7
7 3
6 15
5 11
4 2
3 35
2 23
1 3
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7454ce646/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 0
All done!
Reads Barcodes
7 4
6 3
5 9
4 11
3 13
2 23
1 59
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7454ce646/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 1
7 5
6 2
5 8
4 7
3 14
2 32
1 46
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f7454ce646/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:26:23 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_matched_reads.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Mon May 11 00:26:26 2026 ----------------
00:26:26 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f7454ce646/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f7454ce646/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f7454ce646/sample3_align2genome.bam'
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.72gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 148045.41Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 5.89gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 5.88gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 458734.80Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 514512.27Read/s]
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 25.00gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 399320.61Read/s]
-- Running step: isoform_identification @ Mon May 11 00:26:27 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:26:28 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7454ce646/fastq, /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Mon May 11 00:26:31 2026 ----------
00:26:31 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7454ce646/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7454ce646/sample1_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7454ce646/sample2_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f7454ce646/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f7454ce646/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/Rtmpzwpfa1/file310f745d290e73/config_file_3215220.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Mon May 11 00:26:34 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745d290e73/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads Barcodes
29 1
24 1
22 1
21 2
20 3
19 1
18 2
16 4
15 1
14 1
13 5
11 4
10 7
9 5
8 9
7 3
6 13
5 14
4 2
3 32
2 20
1 6
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745d290e73/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads Barcodes
9 1
8 3
7 1
6 4
5 5
4 8
3 16
2 33
1 50
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745d290e73/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads Barcodes
10 1
9 1
7 1
6 4
5 10
4 7
3 16
2 28
1 51
Loading known barcodes from /tmp/Rtmpzwpfa1/file310f745d290e73/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads Barcodes
10 2
9 2
8 5
7 4
6 3
5 7
4 14
3 14
2 29
1 57
-- Running step: genome_alignment @ Mon May 11 00:26:35 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_align2genome.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_matched_reads.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_align2genome.bam
-- Running step: gene_quantification @ Mon May 11 00:26:58 2026 ----------------
00:26:58 Mon May 11 2026 quantify genes
Using BAM(s): '/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_align2genome.bam',
'/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_align2genome.bam', and
'/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_align2genome.bam'
Counter({'counted_reads': 357, 'not_enough_coverage': 1})
Counter({'counted_reads': 275})
Counter({'counted_reads': 275, 'not_enough_coverage': 1})
Counter({'counted_reads': 357, 'not_enough_coverage': 1})
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 144567.36Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.53gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 488915.00Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.76gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 492104.37Read/s]
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.65gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 374384.46Read/s]
-- Running step: isoform_identification @ Mon May 11 00:26:59 2026 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Mon May 11 00:26:59 2026 -------------------
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745d290e73/fastq, /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample1.fq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample2.fq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample1_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample2_matched_reads.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmpzwpfa1/file310f745d290e73/sample3_matched_reads_dedup.fastq.gz
files found
Realignment complete for the following samples:
/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_realign2transcript.bam
/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Mon May 11 00:27:22 2026 ----------
00:27:22 Mon May 11 2026 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745d290e73/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample1_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745d290e73/sample1_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample2_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745d290e73/sample2_realign2transcript.bamdone
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample3_realign2transcript.bam...
parsing /tmp/Rtmpzwpfa1/file310f745d290e73/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmpzwpfa1/file310f745d290e73/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Filtering for genes with at least 2 detected isoforms ...
6 isoform(s) left.
Aggregating counts by cluster labels ...
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Filtering for genes with at least 2 isoforms expressing more than 1 counts ...
3 gene(s), 6 transcript(s) left.
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
[ FAIL 0 | WARN 182 | SKIP 0 | PASS 98 ]
[ FAIL 0 | WARN 182 | SKIP 0 | PASS 98 ]
Counter({'counted_reads': 358})
Counter({'counted_reads': 275})
Counter({'counted_reads': 272})
Counter({'counted_reads': 358})
>
> proc.time()
user system elapsed
831.674 53.391 867.297
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| BulkPipeline | 4.003 | 0.296 | 4.358 | |
| MultiSampleSCPipeline | 10.280 | 0.724 | 11.074 | |
| SingleCellPipeline | 3.021 | 0.142 | 1.968 | |
| add_gene_counts | 0.359 | 0.030 | 0.389 | |
| annotation_to_fasta | 0.212 | 0.015 | 0.227 | |
| barcode_segment | 0.002 | 0.000 | 0.002 | |
| blaze | 5.122 | 17.407 | 13.363 | |
| bulk_long_pipeline | 2.416 | 10.028 | 2.603 | |
| combine_sce | 0.731 | 0.141 | 0.871 | |
| config-set | 0.255 | 0.043 | 0.298 | |
| config | 0.217 | 0.024 | 0.240 | |
| controllers-set | 0.425 | 0.078 | 0.507 | |
| controllers | 0.290 | 0.024 | 0.312 | |
| convolution_filter | 0.001 | 0.000 | 0.001 | |
| create_config | 0.020 | 0.002 | 0.024 | |
| create_sce_from_dir | 5.960 | 3.069 | 6.862 | |
| create_se_from_dir | 5.297 | 0.250 | 5.533 | |
| cutadapt | 0.106 | 0.019 | 0.125 | |
| example_pipeline | 0.360 | 0.034 | 0.394 | |
| experiment | 4.985 | 0.142 | 5.113 | |
| filter_annotation | 0.048 | 0.005 | 0.053 | |
| filter_coverage | 1.737 | 0.053 | 1.789 | |
| find_barcode | 0.302 | 0.024 | 0.332 | |
| find_bin | 0.004 | 0.001 | 0.004 | |
| find_diversity | 1.745 | 0.533 | 2.223 | |
| find_variants | 21.973 | 2.201 | 23.322 | |
| get_coverage | 1.733 | 0.083 | 1.817 | |
| index_genome | 0.214 | 0.018 | 0.227 | |
| mutation_positions | 1.602 | 0.242 | 1.844 | |
| plot_coverage | 3.741 | 0.083 | 3.825 | |
| plot_demultiplex | 2.783 | 0.128 | 2.913 | |
| plot_demultiplex_raw | 1.357 | 0.046 | 1.404 | |
| plot_durations | 5.090 | 0.129 | 5.206 | |
| plot_isoform_heatmap | 3.088 | 0.204 | 3.293 | |
| plot_isoform_reduced_dim | 21.468 | 0.791 | 22.259 | |
| plot_isoforms | 1.702 | 0.069 | 1.771 | |
| resume_FLAMES | 4.912 | 0.134 | 5.033 | |
| run_FLAMES | 4.899 | 0.147 | 5.036 | |
| run_step | 1.996 | 0.059 | 2.054 | |
| sc_DTU_analysis | 6.621 | 1.833 | 6.497 | |
| sc_genotype | 2.574 | 0.063 | 2.060 | |
| sc_impute_transcript | 0.644 | 0.000 | 0.643 | |
| sc_long_multisample_pipeline | 8.357 | 4.968 | 7.728 | |
| sc_long_pipeline | 3.209 | 1.264 | 2.622 | |
| sc_mutations | 2.643 | 0.288 | 2.356 | |
| sc_plot_genotype | 10.730 | 1.674 | 10.534 | |
| show-FLAMESPipeline | 0.309 | 0.011 | 0.320 | |
| steps-set | 0.463 | 0.007 | 0.470 | |
| steps | 0.142 | 0.006 | 0.147 | |
| weight_transcripts | 0.025 | 0.003 | 0.027 | |