##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings FLAMES_2.3.5.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.1 Patched (2025-08-23 r88802)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.3 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.3.5’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .dockerignore
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  6.0Mb
  sub-directories of 1Mb or more:
    bin    1.1Mb
    data   1.8Mb
    libs   1.5Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification'
  'minimap2_align' 'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable
  ‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_gene_entropy: no visible global function definition for ‘as’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Reads
  Sample Type UMI UMI_count adj.p.value allele allele_count as
  bam_index barcode barcode_rank barcodes_file capture.output
  cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed
  reads demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
plot_isoform_reduced_dim     24.363  0.172  24.534
blaze                         4.478 17.914  13.232
find_variants                20.659  0.059  20.110
bulk_long_pipeline            2.404 12.409   2.568
sc_long_multisample_pipeline  8.238  5.859   8.284
sc_plot_genotype             11.736  0.960  11.550
MultiSampleSCPipeline        10.585  0.742  11.621
sc_DTU_analysis               7.511  2.346   7.435
plot_isoform_heatmap          7.089  0.121   7.211
create_sce_from_dir           3.545  2.919   3.831
sc_long_pipeline              3.156  1.974   2.856
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 5 NOTEs
See
  ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.22-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.3.5’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |                 if (blocks.size() >= (int)this->Min_sup_cnt) {
      |                     ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |         if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |              ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |                 (right_counts.size() < (int)this->Min_sup_cnt)) {
      |                  ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |                                 for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                                                 ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |                         for (int i = 0; i < new_exons.size(); ++i) {
      |                                         ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                            ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |                         for (int i = 0; i < exons.size(); i+=2) {
      |                                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:123:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  123 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::string get_umi(const std::string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’:
main-functions/flexiplex.cpp:164:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  164 |     if (seq.length() < umi_start + umi_length) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:186:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  186 |     if (read_to_subpatterns.size() > umi_index + 1) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:299:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  299 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:358:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  358 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:360:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  360 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:361:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  361 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:400:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  400 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void write_bgzfstring(BGZF*, const std::string&)’:
main-functions/flexiplex.cpp:423:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  423 |   if (bytes_written != str.size()) {
      |       ~~~~~~~~~~~~~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const std::string&, const std::vector<Barcode>&, BGZF*)’:
main-functions/flexiplex.cpp:438:28: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  438 |         (barcode.flank_end == std::string::npos ? "True" : "False") + "\n";
      |          ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, BGZF*, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’:
main-functions/flexiplex.cpp:475:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  475 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:490:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  490 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:495:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  495 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’:
main-functions/flexiplex.cpp:754:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  754 |       for (int t = 0; t < sr_v.size();
      |                       ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:759:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  759 |         for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                         ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:761:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  761 |           for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:763:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  763 |           for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’:
main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  268 |   for (int i = 0; i < BASES.size(); i++) {
      |                   ~~^~~~~~~~~~~~~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’:
main-functions/pileup_readid.cpp:342:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
   86 |   unsigned int end;
      |                ^~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’:
main-functions/pileup_readid.cpp:344:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -std=gnu2x -I"/home/biocbuild/bbs-3.22-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.22-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.22-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.22-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.22-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-g -O2  -Wall -Werror=format-security -Wno-unused-result" minimap2)
make[1]: Entering directory '/home/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/submodule/minimap2'
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  main.c -o main.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kthread.c -o kthread.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kalloc.c -o kalloc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  misc.c -o misc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  bseq.c -o bseq.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sketch.c -o sketch.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sdust.c -o sdust.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  options.c -o options.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  index.c -o index.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  lchain.c -o lchain.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  align.c -o align.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  hit.c -o hit.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  seed.c -o seed.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  jump.c -o jump.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  map.c -o map.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  format.c -o format.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  pe.c -o pe.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  esterr.c -o esterr.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  splitidx.c -o splitidx.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -DHAVE_KALLOC  ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
ar: `u' modifier ignored since `D' is the default (see `U')
cc -g -O2  -Wall -Werror=format-security -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
make[1]: Leaving directory '/home/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/submodule/minimap2'
echo "Installing binary to /home/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /home/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Rust version too old for edition 2024, skipping oarfish installation.
installing to /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R version 4.5.1 Patched (2025-08-23 r88802) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c6490483a/config_file_2621996.json 
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c6490483a/config_file_2621996.json 
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c6490483a/config_file_2621996.json 
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c627b8b6c/config_file_2621996.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c8d00c96/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5cc66121/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5cc66121/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c432024dc/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c432024dc/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c432024dc/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c432024dc/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c1a0fcf1c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c50cd7a8b/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:04:08 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:04:09 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%[00:04:16] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[00:04:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[00:04:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[00:04:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[00:04:19] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[00:04:19] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.


  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:04:36 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpKyMglc/file28022c50cd7a8b/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Tue Oct  7 00:04:37 2025 ----------
2025-10-07T04:04:37.327613Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:04:37.328018Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c50cd7a8b/sample1_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:04:37.328031Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:04:37.328035Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:04:37.328105Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:04:37.328112Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:04:37.329679Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:04:37.329817Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:04:37.329843Z  INFO oarfish::bulk: Total number of alignment records : 116
2025-10-07T04:04:37.329853Z  INFO oarfish::bulk: number of aligned reads : 96
2025-10-07T04:04:37.329856Z  INFO oarfish::bulk: number of unique alignments : 86
2025-10-07T04:04:37.330468Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:04:37.338344Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:04:37.338781Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c50cd7a8b/sample2_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:04:37.338790Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:04:37.338793Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:04:37.338855Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:04:37.338860Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:04:37.340458Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:04:37.340595Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:04:37.340622Z  INFO oarfish::bulk: Total number of alignment records : 114
2025-10-07T04:04:37.340625Z  INFO oarfish::bulk: number of aligned reads : 95
2025-10-07T04:04:37.340627Z  INFO oarfish::bulk: number of unique alignments : 82
2025-10-07T04:04:37.341240Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:04:37.348225Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:04:37.348658Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c50cd7a8b/sample3_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:04:37.348667Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:04:37.348670Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:04:37.348723Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:04:37.348729Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:04:37.351400Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2025-10-07T04:04:37.351561Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

2025-10-07T04:04:37.351599Z  INFO oarfish::bulk: Total number of alignment records : 239
2025-10-07T04:04:37.351601Z  INFO oarfish::bulk: number of aligned reads : 179
2025-10-07T04:04:37.351604Z  INFO oarfish::bulk: number of unique alignments : 143
2025-10-07T04:04:37.352320Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022cad2bc9/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:04:37 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample1_align2genome.bam
sample2 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample2_align2genome.bam
sample3 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:04:59 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:05:21 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpKyMglc/file28022cad2bc9/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:05:40 2025 ----------
2025-10-07T04:05:40.308720Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:05:40.309149Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022cad2bc9/sample1_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:05:40.309175Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:05:40.309179Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:05:40.309252Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:05:40.309258Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:05:40.310785Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:05:40.310924Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:05:40.310948Z  INFO oarfish::bulk: Total number of alignment records : 116
2025-10-07T04:05:40.310950Z  INFO oarfish::bulk: number of aligned reads : 96
2025-10-07T04:05:40.310953Z  INFO oarfish::bulk: number of unique alignments : 86
2025-10-07T04:05:40.311591Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:05:40.321649Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:05:40.322047Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022cad2bc9/sample2_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:05:40.322056Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:05:40.322059Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:05:40.322137Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:05:40.322147Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:05:40.323745Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:05:40.323910Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:05:40.323939Z  INFO oarfish::bulk: Total number of alignment records : 114
2025-10-07T04:05:40.323955Z  INFO oarfish::bulk: number of aligned reads : 95
2025-10-07T04:05:40.323958Z  INFO oarfish::bulk: number of unique alignments : 82
2025-10-07T04:05:40.324581Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:05:40.332422Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:05:40.332797Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022cad2bc9/sample3_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:05:40.332807Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:05:40.332811Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:05:40.332883Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:05:40.332889Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:05:40.335589Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2025-10-07T04:05:40.335763Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

2025-10-07T04:05:40.335802Z  INFO oarfish::bulk: Total number of alignment records : 239
2025-10-07T04:05:40.335805Z  INFO oarfish::bulk: number of aligned reads : 179
2025-10-07T04:05:40.335807Z  INFO oarfish::bulk: number of unique alignments : 143
2025-10-07T04:05:40.336492Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c18bba436/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:05:40 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpKyMglc/file28022c18bba436/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpKyMglc/file28022c18bba436/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpKyMglc/file28022c18bba436/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:05:41 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:06:01 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpKyMglc/file28022c18bba436/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpKyMglc/file28022c18bba436/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpKyMglc/file28022c18bba436/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:06:01 2025 ----------
00:06:01 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c80c14a1/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:06:03 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample1_align2genome.bam
sample2 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample2_align2genome.bam
sample3 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:06:21 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:06:41 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpKyMglc/file28022c80c14a1/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:06:59 2025 ----------
00:06:59 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/RtmpKyMglc/file28022c18bba436/sample1_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c18bba436/sample2_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c18bba436/sample3_realign2transcript.bam'] /tmp/RtmpKyMglc/file28022c18bba436/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c5e1b40a4/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:07:00 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:07:01 2025 -------------
Inputs:  ['/tmp/RtmpKyMglc/file28022c80c14a1/sample1_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c80c14a1/sample2_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c80c14a1/sample3_realign2transcript.bam'] /tmp/RtmpKyMglc/file28022c80c14a1/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:07:01 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpKyMglc/file28022c5e1b40a4/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Tue Oct  7 00:07:02 2025 ----------
2025-10-07T04:07:02.829954Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:02.830348Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c5e1b40a4/sample1_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:02.830360Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:02.830364Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:02.830438Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:02.830446Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:02.833054Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:02.833201Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:02.833231Z  INFO oarfish::bulk: Total number of alignment records : 125
2025-10-07T04:07:02.833234Z  INFO oarfish::bulk: number of aligned reads : 98
2025-10-07T04:07:02.833236Z  INFO oarfish::bulk: number of unique alignments : 86
2025-10-07T04:07:02.833838Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:07:02.841193Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:02.841586Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c5e1b40a4/sample2_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:02.841595Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:02.841598Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:02.841668Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:02.841674Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:02.844300Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:02.844452Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:02.844478Z  INFO oarfish::bulk: Total number of alignment records : 136
2025-10-07T04:07:02.844481Z  INFO oarfish::bulk: number of aligned reads : 97
2025-10-07T04:07:02.844483Z  INFO oarfish::bulk: number of unique alignments : 79
2025-10-07T04:07:02.845127Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:07:02.852784Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:02.853258Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c5e1b40a4/sample3_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:02.853270Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:02.853274Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:02.853350Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:02.853357Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:02.857710Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:02.857896Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:02.857926Z  INFO oarfish::bulk: Total number of alignment records : 272
2025-10-07T04:07:02.857929Z  INFO oarfish::bulk: number of aligned reads : 187
2025-10-07T04:07:02.857932Z  INFO oarfish::bulk: number of unique alignments : 140
2025-10-07T04:07:02.858640Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c1849076/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:07:03 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c1849076/sample1_align2genome.bam
sample2 ->/tmp/RtmpKyMglc/file28022c1849076/sample2_align2genome.bam
sample3 ->/tmp/RtmpKyMglc/file28022c1849076/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:07:21 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:07:21 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c1849076/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpKyMglc/file28022c1849076/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpKyMglc/file28022c1849076/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:07:41 2025 ----------
2025-10-07T04:07:41.131472Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:41.131989Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c1849076/sample1_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:41.132001Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:41.132018Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:41.132111Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:41.132129Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:41.134855Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:41.135006Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:41.135028Z  INFO oarfish::bulk: Total number of alignment records : 125
2025-10-07T04:07:41.135031Z  INFO oarfish::bulk: number of aligned reads : 98
2025-10-07T04:07:41.135033Z  INFO oarfish::bulk: number of unique alignments : 86
2025-10-07T04:07:41.135662Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:07:41.148721Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:41.149784Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c1849076/sample2_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:41.149798Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:41.149801Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:41.149882Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:41.149889Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:41.152562Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:41.152721Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:41.152754Z  INFO oarfish::bulk: Total number of alignment records : 136
2025-10-07T04:07:41.152757Z  INFO oarfish::bulk: number of aligned reads : 97
2025-10-07T04:07:41.152771Z  INFO oarfish::bulk: number of unique alignments : 79
2025-10-07T04:07:41.153388Z  INFO oarfish: oarfish completed successfully.
2025-10-07T04:07:41.165362Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:07:41.165738Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c1849076/sample3_realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:07:41.165746Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:07:41.165750Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:07:41.165827Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:07:41.165834Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:07:41.170148Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2025-10-07T04:07:41.170321Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

2025-10-07T04:07:41.170350Z  INFO oarfish::bulk: Total number of alignment records : 272
2025-10-07T04:07:41.170353Z  INFO oarfish::bulk: number of aligned reads : 187
2025-10-07T04:07:41.170355Z  INFO oarfish::bulk: number of unique alignments : 140
2025-10-07T04:07:41.171051Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c5cdec8/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:07:41 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:07:42 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:07:42 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpKyMglc/file28022c5cdec8/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:07:43 2025 ----------
00:07:43 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c1e114120/config_file_2621996.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Oct  7 00:07:44 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c1e114120/sample1_align2genome.bam
sample2 ->/tmp/RtmpKyMglc/file28022c1e114120/sample2_align2genome.bam
sample3 ->/tmp/RtmpKyMglc/file28022c1e114120/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:08:03 2025 -------------
Inputs:  ['/tmp/RtmpKyMglc/file28022c5cdec8/sample1_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c5cdec8/sample2_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c5cdec8/sample3_realign2transcript.bam'] /tmp/RtmpKyMglc/file28022c5cdec8/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:08:03 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpKyMglc/file28022c1e114120/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpKyMglc/file28022c1e114120/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpKyMglc/file28022c1e114120/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:08:22 2025 ----------
00:08:22 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c7385486a/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:08:23 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7385486a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:08:23 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c7385486a/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c7385486a/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:08:23 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:08:33 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7385486a/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7385486a/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpKyMglc/file28022c7385486a/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c7385486a/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Tue Oct  7 00:08:34 2025 ----------
2025-10-07T04:08:34.021220Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:08:34.021612Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7385486a/realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:08:34.021621Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:08:34.021624Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:08:34.021691Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:08:34.021696Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:08:34.027771Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c46fbc59c/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:08:34 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c46fbc59c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:08:34 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c46fbc59c/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c46fbc59c/align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:08:52 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:09:03 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c46fbc59c/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c46fbc59c/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c46fbc59c/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c46fbc59c/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:09:21 2025 ----------
2025-10-07T04:09:21.388459Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:09:21.388862Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c46fbc59c/realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:09:21.388872Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:09:21.388876Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:09:21.388939Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:09:21.388945Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:09:21.395463Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c17303046/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:09:21 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c17303046/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:09:22 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c17303046/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c17303046/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:09:22 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:09:33 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c17303046/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c17303046/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpKyMglc/file28022c17303046/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c17303046/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:09:33 2025 ----------
00:09:33 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Inputs:  ['/tmp/RtmpKyMglc/file28022c1e114120/sample1_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c1e114120/sample2_realign2transcript.bam', '/tmp/RtmpKyMglc/file28022c1e114120/sample3_realign2transcript.bam'] /tmp/RtmpKyMglc/file28022c1e114120/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c44209bd1/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:09:34 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c44209bd1/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:09:34 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c44209bd1/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c44209bd1/align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:09:52 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:10:02 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c44209bd1/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c44209bd1/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c44209bd1/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c44209bd1/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:10:19 2025 ----------
00:10:19 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c7215fc68/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:10:20 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7215fc68/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:10:21 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c7215fc68/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c7215fc68/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:10:21 2025 -------------
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:10:21 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7215fc68/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7215fc68/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpKyMglc/file28022c7215fc68/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c7215fc68/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Tue Oct  7 00:10:21 2025 ----------
2025-10-07T04:10:21.949629Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:10:21.950052Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7215fc68/realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:10:21.950061Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:10:21.950064Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:10:21.950166Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:10:21.950177Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:10:21.959701Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c76e4e592/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:10:22 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c76e4e592/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:10:22 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c76e4e592/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c76e4e592/align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:10:40 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:10:41 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c76e4e592/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c76e4e592/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c76e4e592/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c76e4e592/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:10:58 2025 ----------
2025-10-07T04:10:58.532651Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:10:58.533321Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c76e4e592/realign2transcript.bam, contains 10 reference sequences.
2025-10-07T04:10:58.533335Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:10:58.533339Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:10:58.533425Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:10:58.533433Z  INFO oarfish: parsed reference information for 10 transcripts.
2025-10-07T04:10:58.544178Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c646feb33/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:10:59 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c646feb33/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:10:59 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c646feb33/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c646feb33/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Oct  7 00:10:59 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:11:00 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c646feb33/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c646feb33/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpKyMglc/file28022c646feb33/matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c646feb33/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:11:00 2025 ----------
00:11:00 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c6a5b0b30/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:11:01 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c6a5b0b30/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Oct  7 00:11:01 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c6a5b0b30/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c6a5b0b30/align2genome.bam
-- Running step: isoform_identification @ Tue Oct  7 00:11:21 2025 -------------
	Counter({'counted_reads': 368, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:11:21 2025 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c6a5b0b30/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c6a5b0b30/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c6a5b0b30/matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c6a5b0b30/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:11:39 2025 ----------
00:11:39 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c361b48da/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:11:40 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c361b48da/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c361b48da/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c361b48da/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c361b48da/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:11:41 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c361b48da/sampleA_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c361b48da/sample1_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c361b48da/sample2_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c361b48da/sample3_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Oct  7 00:11:43 2025 ----------------
00:11:43 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c361b48da/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c361b48da/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c361b48da/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c361b48da/sample3_align2genome.bam'
	Counter({'counted_reads': 368, 'unmapped': 4})
parsing /tmp/RtmpKyMglc/file28022c361b48da/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 20.39gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 373411.20Read/s]
parsing /tmp/RtmpKyMglc/file28022c361b48da/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 40.78gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1153675.87Read/s]
parsing /tmp/RtmpKyMglc/file28022c361b48da/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 47.78gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1183761.57Read/s]
parsing /tmp/RtmpKyMglc/file28022c361b48da/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.03gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 635616.17Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:11:45 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:12:09 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c361b48da/fastq, /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c361b48da/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c361b48da/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c361b48da/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c361b48da/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpKyMglc/file28022c361b48da/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c361b48da/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c361b48da/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c361b48da/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c361b48da/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Tue Oct  7 00:12:10 2025 ----------
2025-10-07T04:12:10.570740Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:12:10.571248Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c361b48da/sampleA_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:12:10.571354Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:12:10.571358Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:12:10.571439Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:12:10.571445Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:12:10.577494Z  INFO oarfish::single_cell: Processed 100 cells.
2025-10-07T04:12:10.856982Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:12:10.857467Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c361b48da/sample1_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:12:10.857481Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:12:10.857484Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:12:10.857558Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:12:10.857565Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:12:11.138971Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:12:11.139565Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c361b48da/sample2_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:12:11.139579Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:12:11.139582Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:12:11.139650Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:12:11.139656Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:12:11.434558Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:12:11.435136Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c361b48da/sample3_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:12:11.435149Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:12:11.435153Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:12:11.435216Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:12:11.435222Z  INFO oarfish: parsed reference information for 5 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c7c828e26/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:12:11 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7c828e26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7c828e26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7c828e26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c7c828e26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:12:12 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c7c828e26/sampleA_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sampleA_align2genome.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample1_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample1_align2genome.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample2_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample2_align2genome.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample3_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Oct  7 00:12:31 2025 ----------------
00:12:31 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c7c828e26/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c7c828e26/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c7c828e26/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c7c828e26/sample3_align2genome.bam'
parsing /tmp/RtmpKyMglc/file28022c7c828e26/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.24gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 353615.49Read/s]
parsing /tmp/RtmpKyMglc/file28022c7c828e26/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 47.19gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1384990.09Read/s]
parsing /tmp/RtmpKyMglc/file28022c7c828e26/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 48.98gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1293420.50Read/s]
parsing /tmp/RtmpKyMglc/file28022c7c828e26/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 34.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 756275.51Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:12:32 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:12:57 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7c828e26/fastq, /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7c828e26/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c7c828e26/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c7c828e26/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c7c828e26/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sampleA_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample1_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample2_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c7c828e26/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c7c828e26/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:13:17 2025 ----------
2025-10-07T04:13:17.583179Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:13:17.583648Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7c828e26/sampleA_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:13:17.583657Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:13:17.583660Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:13:17.583721Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:13:17.583727Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:13:17.590023Z  INFO oarfish::single_cell: Processed 100 cells.
2025-10-07T04:13:17.947895Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:13:17.948421Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7c828e26/sample1_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:13:17.948433Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:13:17.948437Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:13:17.948508Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:13:17.948514Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:13:18.288808Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:13:18.289283Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7c828e26/sample2_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:13:18.289296Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:13:18.289300Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:13:18.289365Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:13:18.289371Z  INFO oarfish: parsed reference information for 5 transcripts.
2025-10-07T04:13:18.602175Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:13:18.602721Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c7c828e26/sample3_realign2transcript.bam, contains 5 reference sequences.
2025-10-07T04:13:18.602731Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:13:18.602734Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:13:18.602811Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:13:18.602818Z  INFO oarfish: parsed reference information for 5 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c4e131890/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:13:19 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4e131890/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4e131890/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4e131890/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4e131890/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:13:19 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c4e131890/sampleA_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4e131890/sample1_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4e131890/sample2_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4e131890/sample3_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Oct  7 00:13:21 2025 ----------------
00:13:21 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c4e131890/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c4e131890/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c4e131890/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c4e131890/sample3_align2genome.bam'
parsing /tmp/RtmpKyMglc/file28022c4e131890/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.51gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 378916.63Read/s]
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 51.45gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1254577.65Read/s]
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 48.67gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1151142.83Read/s]
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 32.71gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 681026.17Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:13:22 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:13:46 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4e131890/fastq, /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c4e131890/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4e131890/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4e131890/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4e131890/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpKyMglc/file28022c4e131890/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c4e131890/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c4e131890/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c4e131890/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4e131890/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:13:47 2025 ----------
00:13:47 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpKyMglc/file28022c4e131890/sampleA_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c4e131890/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c4e131890/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample1_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c4e131890/sample1_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample2_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c4e131890/sample2_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample3_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c4e131890/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c4e131890/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c216e415e/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:13:49 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c216e415e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c216e415e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c216e415e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c216e415e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:13:49 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c216e415e/sampleA_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sampleA_align2genome.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample1_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample1_align2genome.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample2_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample2_align2genome.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample3_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Oct  7 00:14:11 2025 ----------------
00:14:11 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c216e415e/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c216e415e/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c216e415e/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c216e415e/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
parsing /tmp/RtmpKyMglc/file28022c216e415e/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 358646.92Read/s]
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 46.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1224542.80Read/s]
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 47.95gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1133595.68Read/s]
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 34.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 681468.77Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:14:12 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Oct  7 00:14:36 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c216e415e/fastq, /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c216e415e/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c216e415e/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c216e415e/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c216e415e/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c216e415e/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sampleA_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample1_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample2_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c216e415e/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c216e415e/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:14:55 2025 ----------
00:14:55 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpKyMglc/file28022c216e415e/sampleA_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c216e415e/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c216e415e/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample1_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c216e415e/sample1_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample2_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c216e415e/sample2_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample3_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c216e415e/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c216e415e/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c4f3e3e02/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:14:57 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4f3e3e02/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4f3e3e02/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4f3e3e02/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c4f3e3e02/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:14:57 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Oct  7 00:14:59 2025 ----------------
00:14:59 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
parsing /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 22.10gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 356403.93Read/s]
parsing /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 41.92gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1379886.83Read/s]
parsing /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 49.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1145483.94Read/s]
parsing /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 34.69gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 742302.14Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:15:00 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:15:00 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq, /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Tue Oct  7 00:15:02 2025 ----------
2025-10-07T04:15:02.719520Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:02.720155Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c4f3e3e02/sampleA_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:02.720165Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:02.720168Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:02.720258Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:02.720267Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:02.732282Z  INFO oarfish::single_cell: Processed 100 cells.
2025-10-07T04:15:03.269870Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:03.270518Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c4f3e3e02/sample1_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:03.270533Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:03.270537Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:03.270652Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:03.270661Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:03.832290Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:03.832777Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c4f3e3e02/sample2_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:03.832787Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:03.832790Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:03.832875Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:03.832884Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:04.359237Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:04.359720Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c4f3e3e02/sample3_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:04.359731Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:04.359734Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:04.359817Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:04.359825Z  INFO oarfish: parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c77cd2d3b/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:15:05 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c77cd2d3b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c77cd2d3b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c77cd2d3b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c77cd2d3b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:15:05 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_align2genome.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_align2genome.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_align2genome.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Oct  7 00:15:25 2025 ----------------
00:15:25 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_align2genome.bam'
parsing /tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 16.56gene_group/s]
/home/biocbuild/bbs-3.22-bioc/R/site-library/FLAMES/python/count_gene.py:705: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 377906.08Read/s]
parsing /tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 48.08gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1381159.11Read/s]
parsing /tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 51.37gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1265479.12Read/s]
parsing /tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 33.43gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 770218.89Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:15:26 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:15:27 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq, /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:15:46 2025 ----------
2025-10-07T04:15:46.968788Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:46.969259Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c77cd2d3b/sampleA_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:46.969281Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:46.969294Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:46.969385Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:46.969394Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:46.981760Z  INFO oarfish::single_cell: Processed 100 cells.
2025-10-07T04:15:47.598091Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:47.598488Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c77cd2d3b/sample1_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:47.598499Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:47.598502Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:47.598591Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:47.598599Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:48.202459Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:48.202839Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c77cd2d3b/sample2_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:48.202847Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:48.202850Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:48.202938Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:48.202946Z  INFO oarfish: parsed reference information for 14 transcripts.
2025-10-07T04:15:48.713531Z  INFO oarfish: setting user-provided filter parameters.
2025-10-07T04:15:48.713941Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpKyMglc/file28022c77cd2d3b/sample3_realign2transcript.bam, contains 14 reference sequences.
2025-10-07T04:15:48.713949Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2025-10-07T04:15:48.713952Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2025-10-07T04:15:48.714042Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2025-10-07T04:15:48.714050Z  INFO oarfish: parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c6902ca6b/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:15:49 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c6902ca6b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c6902ca6b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c6902ca6b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c6902ca6b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:15:50 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_matched_reads.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Oct  7 00:15:51 2025 ----------------
00:15:51 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c6902ca6b/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c6902ca6b/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c6902ca6b/sample3_align2genome.bam'
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 22.84gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 373743.94Read/s]
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  8.63gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  8.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1227409.58Read/s]
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 52.51gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1168069.51Read/s]
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 34.98gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 712057.59Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:15:52 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:15:53 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c6902ca6b/fastq, /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Oct  7 00:15:54 2025 ----------
00:15:54 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c6902ca6b/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c6902ca6b/sample1_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c6902ca6b/sample2_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c6902ca6b/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c6902ca6b/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpKyMglc/file28022c5f36201c/config_file_2621996.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Oct  7 00:15:57 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5f36201c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5f36201c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5f36201c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpKyMglc/file28022c5f36201c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Tue Oct  7 00:15:57 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_align2genome.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample1_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample1_align2genome.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample2_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample2_align2genome.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample3_matched_reads.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Oct  7 00:16:16 2025 ----------------
00:16:16 Tue Oct 07 2025 quantify genes 
Using BAM(s): '/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c5f36201c/sample1_align2genome.bam',
'/tmp/RtmpKyMglc/file28022c5f36201c/sample2_align2genome.bam', and
'/tmp/RtmpKyMglc/file28022c5f36201c/sample3_align2genome.bam'
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 91})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 176})
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.42gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 390953.36Read/s]
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 50.12gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1396983.75Read/s]
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 52.05gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1270847.17Read/s]
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.36gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 766110.91Read/s]
-- Running step: isoform_identification @ Tue Oct  7 00:16:17 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Oct  7 00:16:17 2025 -------------------
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c5f36201c/fastq, /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample1.fq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample2.fq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c5f36201c/sampleA_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample1_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample2_matched_reads.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpKyMglc/file28022c5f36201c/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpKyMglc/file28022c5f36201c/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample1_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample2_realign2transcript.bam
/tmp/RtmpKyMglc/file28022c5f36201c/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpKyMglc/file28022c5f36201c/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Oct  7 00:16:36 2025 ----------
00:16:36 Tue Oct 07 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sampleA_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c5f36201c/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample1_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c5f36201c/sample1_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample2_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c5f36201c/sample2_realign2transcript.bamdone
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample3_realign2transcript.bam...
parsing /tmp/RtmpKyMglc/file28022c5f36201c/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpKyMglc/file28022c5f36201c/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
[ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ]

[ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ]
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 91})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 176})
> 
> proc.time()
    user   system  elapsed 
1712.714   47.068  771.494