ShortRead 1.71.0
The ShortRead package provides functionality for working with FASTQ files from high throughput sequence analysis. The package also contains functions for legacy (single-end, ungapped) aligned reads; for working with BAM files, please see the Rsamtools, GenomicRanges, GenomicAlignments and related packages.
Sample FASTQ data are derived from ArrayExpress record E-MTAB-1147. Paired-end FASTQ files were retrieved and then sampled to 20,000 records with
sampler <- FastqSampler('E-MTAB-1147/fastq/ERR127302_1.fastq.gz', 20000)
set.seed(123); ERR127302_1 <- yield(sampler)
sampler <- FastqSampler('E-MTAB-1147/fastq/ERR127302_2.fastq.gz', 20000)
set.seed(123); ERR127302_2 <- yield(sampler)
Functionality is summarized in Table 1.
Input FASTQ files are large so processing involves iteration in ‘chunks’
using FastqStreamer
strm <- FastqStreamer("a.fastq.gz")
repeat {
fq <- yield(strm)
if (length(fq) == 0)
break
## process chunk
}
or drawing a random sample from the file
sampler <- FastqSampler("a.fastq.gz")
fq <- yield(sampler)
The default size for both streams and samples is 1M records; this volume of data
fits easily into memory. Use countFastq to get a quick and memory-efficient
count of the number of records and nucleotides in a file
| Input | |
|---|---|
FastqStreamer |
Iterate through FASTQ files in chunks |
FastqSampler |
Draw random samples from FASTQ files |
readFastq |
Read an entire FASTQ file into memory |
writeFastq |
Write FASTQ objects to a connection (file) |
countFastq |
Quickly count FASTQ records in files |
| Sequence and quality summary | |
|---|---|
alphabetFrequency |
Nucleotide or quality score use per read |
alphabetByCycle |
Nucleotide or quality score use by cycle |
alphabetScore |
Whole-read quality summary |
encoding |
Character / ‘phred’ score mapping |
| Quality assessment | |
|---|---|
qa |
Visit FASTQ files to collect QA statistics |
report |
Generate a quality assessment report |
| Filtering and trimming | |
|---|---|
srFilter |
Pre-defined and bespoke filters |
trimTails, etc. |
Trim low-quality nucleotides |
narrow |
Remove leading / trailing nucleotides |
tables |
Summarize read occurrence |
srduplicated, etc. |
Identify duplicate reads |
filterFastq |
Filter reads from one file to another |
fl <- system.file(package="ShortRead", "extdata", "E-MTAB-1147",
"ERR127302_1_subset.fastq.gz")
countFastq(fl)
## records nucleotides scores
## ERR127302_1_subset.fastq.gz 20000 1440000 1440000
Small FASTQ files can be read into memory in their entirety using readFastq;
we do this for our sample data
fq <- readFastq(fl)
The result of data input is an instance of class ShortReadQ (Table
2). This class contains reads, their quality scores, and
optionally the id of the read.
| DNAStringSet | (Biostrings) Short read sequences |
| FastqQuality, etc. | Quality encodings |
| ShortReadQ | Reads, quality scores, and ids |
fq
## class: ShortReadQ
## length: 20000 reads; width: 72 cycles
fq[1:5]
## class: ShortReadQ
## length: 5 reads; width: 72 cycles
head(sread(fq), 3)
## DNAStringSet object of length 3:
## width seq
## [1] 72 GTCTGCTGTATCTGTGTCGGCTGTCTCGCGGGAC...GTCAATGAAGGCCTGGAATGTCACTACCCCCAG
## [2] 72 CTAGGGCAATCTTTGCAGCAATGAATGCCAATGG...CAGTGGCTTTTGAGGCCAGAGCAGACCTTCGGG
## [3] 72 TGGGCTGTTCCTTCTCACTGTGGCCTGACTAAAA...TGGCATTAAGAAAGAGTCACGTTTCCCAAGTCT
head(quality(fq), 3)
## class: FastqQuality
## quality:
## BStringSet object of length 3:
## width seq
## [1] 72 HHHHHHHHHHHHHHHHHHHHEBDBB?B:BBGG<D...ABFEFBDBD@DDECEE3>:?;@@@>?=BAB?##
## [2] 72 IIIIHIIIGIIIIIIIHIIIIEGBGHIIIIHGII...IIIHIIIHIIIIIGIIIEGIIGBGE@DDGGGIG
## [3] 72 GGHBHGBGGGHHHHDHHHHHHHHHFGHHHHHHHH...HHHHHHHHGHFHHHHHHHHHHHHHH8AGDGGG>
The reads are represented as DNAStringSet instances, and can be manipulated with the rich tools defined in the Biostrings package. The quality scores are represented by a class that represents the quality encoding inferred from the file; the encoding in use can be discovered with
encoding(quality(fq))
## ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 :
## 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
## ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T
## 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51
## U V W X Y Z [ \\ ] ^ _ ` a b c d e f g h i j k l m n
## 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77
## o p q r s t u v w x y z { | } ~
## 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93
The primary source of documentation for these classes is ?ShortReadQ and
?QualityScore.
FASTQ files are often used for basic quality assessment, often to augment the purely technical QA that might be provided by the sequencing center with QA relevant to overall experimental design. A QA report is generated by creating a vector of paths to FASTQ files
fls <- dir("/path/to", "*fastq$", full=TRUE)
collecting statistics over the files
qaSummary <- qa(fls, type="fastq")
and creating and viewing a report
browseURL(report(qaSummary))
By default, the report is based on a sample of 1M reads.
These QA facilities are easily augmented by writing custom functions for reads
sampled from files, or by exploiting the elements of the object returned from
qa(), e.g., for an analysis of ArrayExpress experiment E-MTAB-1147:
qaSummary
## class: FastqQA(10)
## QA elements (access with qa[["elt"]]):
## readCounts: data.frame(16 3)
## baseCalls: data.frame(16 5)
## readQualityScore: data.frame(8192 4)
## baseQuality: data.frame(1504 3)
## alignQuality: data.frame(16 3)
## frequentSequences: data.frame(800 4)
## sequenceDistribution: data.frame(1953 4)
## perCycle: list(2)
## baseCall: data.frame(5681 4)
## quality: data.frame(44246 5)
## perTile: list(2)
## readCounts: data.frame(0 4)
## medianReadQualityScore: data.frame(0 4)
## adapterContamination: data.frame(16 1)
For instance, the count of reads in each lane is summarized in the readCounts
element, and can be displayed as
head(qaSummary[["readCounts"]])
## read filter aligned
## ERR127302_1.fastq.gz 29741852 NA NA
## ERR127302_2.fastq.gz 29741852 NA NA
## ERR127303_1.fastq.gz 32665567 NA NA
## ERR127303_2.fastq.gz 32665567 NA NA
## ERR127304_1.fastq.gz 31876181 NA NA
## ERR127304_2.fastq.gz 31876181 NA NA
head(qaSummary[["baseCalls"]])
## A C G T N
## ERR127302_1.fastq.gz 16439860 19641395 19547421 16335620 35704
## ERR127302_2.fastq.gz 16238041 20020655 19608896 16060661 71747
## ERR127303_1.fastq.gz 16826258 19204659 19448727 16507994 12362
## ERR127303_2.fastq.gz 16426991 19822132 19374419 16324978 51480
## ERR127304_1.fastq.gz 16279217 19740457 19879137 16089405 11784
## ERR127304_2.fastq.gz 15984998 20297064 19812474 15853510 51954
The readCounts element contains a data frame with 1 row and 3 columns (these
dimensions are indicated in the parenthetical annotation of readCounts in the
output of qaSummary). The rows represent different lanes. The columns
indicated the number of reads, the number of reads surviving the Solexa
filtering criteria, and the number of reads aligned to the reference genome for
the lane. The baseCalls element summarizes the base calls in the unfiltered
reads.
The functions that produce the report tables and graphics are internal to the package. They can be accessed by calling ShortRead:::functionName where functionName is one of the functions listed below, organized by report section.
It is straightforward to create filters to eliminate reads or to trim reads based on diverse characteristics. The basic structure is to open a FASTQ file, iterate through chunks of the file, performing filtering or trimming steps, and appending the filtered data to a new file.
myFilterAndTrim <-
function(fl, destination=sprintf("%s_subset", fl))
{
## open input stream
stream <- open(FastqStreamer(fl))
on.exit(close(stream))
repeat {
## input chunk
fq <- yield(stream)
if (length(fq) == 0)
break
## trim and filter, e.g., reads cannot contain 'N'...
fq <- fq[nFilter()(fq)] # see ?srFilter for pre-defined filters
## trim as soon as 2 of 5 nucleotides has quality encoding less
## than "4" (phred score 20)
fq <- trimTailw(fq, 2, "4", 2)
## drop reads that are less than 36nt
fq <- fq[width(fq) >= 36]
## append to destination
writeFastq(fq, destination, "a")
}
}
This is memory efficient and flexible. Care must be taken to coordinate pairs of FASTQ files representing paired-end reads, to preserve order.
ShortRead provides a variety of methods to read data into R,
in addition to readAligned.
readXStringColumnsreadXStringColumns reads a column of DNA or other sequence-like data. For
instance, the Solexa files s_N_export.txt contain lines with the following
information:
## location of file
exptPath <- system.file("extdata", package="ShortRead")
sp <- SolexaPath(exptPath)
pattern <- "s_2_export.txt"
fl <- file.path(analysisPath(sp), pattern)
strsplit(readLines(fl, n=1), "\t")
## [[1]]
## [1] "HWI-EAS88" "3"
## [3] "2" "1"
## [5] "451" "945"
## [7] "" ""
## [9] "CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC" "YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH"
## [11] "NM" ""
## [13] "" ""
## [15] "" ""
## [17] "" ""
## [19] "" ""
## [21] "" "N"
length(readLines(fl))
## [1] 1000
Column 9 is the read, and column 10 the ASCII-encoded Solexa Fastq quality score; there are 1000 lines (i.e., 1000 reads) in this sample file.
Suppose the task is to read column 9 as a DNAStringSet and column 10 as a
BStringSet. DNAStringSet is a class that contains IUPAC-encoded DNA strings
(IUPAC code allows for nucleotide ambiguity); BStringSet is a class that
contains any character with ASCII code 0 through 255. Both of these classes are
defined in the Biostrings package. readXStringColumns allows us
to read in columns of text as these classes.
Important arguments for readXStringColumns are the dirPath in which to look
for files, the pattern of files to parse, and the colClasses of the columns
to be parsed. The dirPath and pattern arguments are like list.files.
colClasses is like the corresponding argument to read.table: it is a list
specifying the class of each column to be read, or NULL if the column is to be
ignored. In our case, there are 21 columns, and we would like to read in columns
9 and 10. Hence
colClasses <- rep(list(NULL), 21)
colClasses[9:10] <- c("DNAString", "BString")
names(colClasses)[9:10] <- c("read", "quality")
We use the class of the type of sequence (e.g., DNAString or BString),
rather than the class of the set that we will create ( e.g., DNAStringSet or
BStringSet). Applying names to colClasses is not required, but makes
subsequent manipulation easier. We are now ready to read our file
cols <- readXStringColumns(analysisPath(sp), pattern, colClasses)
cols
## $read
## DNAStringSet object of length 1000:
## width seq
## [1] 35 CCAGAGCCCCCCGCTCACTCCTGAACCAGTCTCTC
## [2] 35 AGCCTCCCTCTTTCTGAATATACGGCAGAGCTGTT
## [3] 35 ACCAAAAACACCACATACACGAGCAACACACGTAC
## [4] 35 AATCGGAAGAGCTCGTATGCCGGCTTCTGCTTGGA
## [5] 35 AAAGATAAACTCTAGGCCACCTCCTCCTTCTTCTA
## ... ... ...
## [996] 35 GTGGCAGCGGTGAGGCGGCGGGGGGGGGTTGTTTG
## [997] 35 GTCGGAGGTCAGCAAGCTGTAGTCGGTGTAAAGCT
## [998] 35 GTCATAAATTGGACAGTGTGGCTCCAGTATTCTCA
## [999] 35 ATCTACATTAAGGTCAATTACAATGATAAATAAAA
## [1000] 35 TTCTCAGCCATTCAGTATTCCTCAGGTGAAAATTC
##
## $quality
## BStringSet object of length 1000:
## width seq
## [1] 35 YQMIMIMMLMMIGIGMFICMFFFIMMHIIHAAGAH
## [2] 35 ZXZUYXZQYYXUZXYZYYZZXXZZIMFHXQSUPPO
## [3] 35 LGDHLILLLLLLLIGFLLALDIFDILLHFIAECAE
## [4] 35 JJYYIYVSYYYYYYYYSDYYWVUYYNNVSVQQELQ
## [5] 35 LLLILIIIDLLHLLLLLLLLLLLALLLLHLLLLEL
## ... ... ...
## [996] 35 ZZZZZZZYZZYUYZYUYZKYUDUZIYYODJGUGAA
## [997] 35 ZZZZZZZZZZZZZZZZZZYZZYXXZYSSXXUUHHQ
## [998] 35 ZZZZZZZZZZZZZZZYZZZZYZZZZYZZXZUUUUS
## [999] 35 ZZZZZZZZZZZYXZYZYZZYZYZZXKZSYXUUNUN
## [1000] 35 ZZZZZZZZZZZZZZYZZZZZZZZYYSYSZXUUUUU
The file has been parsed, and appropriate data objects were created.
A feature of readXStringColumns and other input functions in the
ShortRead package is that all files matching pattern in the
specified dirPath will be read into a single object. This provides a
convenient way to, for instance, parse all tiles in a Solexa lane into a single
DNAStringSet object.
There are several advantages to reading columns as XStringSet objects. These are more compact than the corresponding character representation:
object.size(cols$read)
## 51032 bytes
object.size(as.character(cols$read))
## 102128 bytes
They are also created much more quickly. And the DNAStringSet and related classes are used extensively in ShortRead, Biostrings, BSgenome and other packages relevant to short-read technology.
Short reads can be sorted using srsort, or the permutation required to bring
the short read into lexicographic order can be determined using srorder. These
functions are different from sort and order because the result is
independent of the locale, and they operate quickly on DNAStringSet and
BStringSet objects.
The function srduplicated identifies duplicate reads. This function returns a
logical vector, similar to duplicated. The negation of the result from
srduplicated is useful to create a collection of unique reads. An experimental
scenario where this might be useful is when the sample preparation involved PCR.
In this case, replicate reads may be due to artifacts of sample preparation,
rather than differential representation of sequence in the sample prior to PCR.
The tables function summarizes read occurrences, for instance,
tbls <- tables(fq)
names(tbls)
## [1] "top" "distribution"
tbls$top[1:5]
## CTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGC
## 7
## GTTTGGTCTAGGGTGTAGCCTGAGAATAGGGGAAATCAGTGAATGAAGCCTCCTATGATGGCAAATACAGCT
## 7
## CGATAACGTTGTAGATGTGGTCGTTACCTAGAAGGTTGCCTGGCTGGCCCAGCTCGGCTCGAATAAGGAGGC
## 6
## CTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTA
## 6
## CACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCG
## 5
head(tbls$distribution)
## nOccurrences nReads
## 1 1 19291
## 2 2 247
## 3 3 34
## 4 4 18
## 5 5 3
## 6 6 2
The top component returned by tables is a list tallying the most commonly
occurring sequences in the short reads. Knowledgeable readers will recognize the
top-occurring read as a close match to one of the manufacturer adapters.
The distribution component returned by tables is a data frame that
summarizes how many reads (e.g., 19291) are
represented exactly 1 times.
Facilities exist for finding reads that are near matches to specific sequences,
e.g., manufacturer adapter or primer sequences. srdistance reports the edit
distance between each read and a reference sequence. srdistance is implemented
to work efficiently for reference sequences whose length is of the same order as
the reads themselves (10’s to 100’s of bases). To find reads close to the most
common read in the example above, one might say
dist <- srdistance(sread(fq), names(tbls$top)[1])[[1]]
table(dist)[1:10]
## dist
## 0 4 6 10 14 18 20 21 31 32
## 7 1 3 1 3 1 4 1 3 11
‘Near’ matches can be filtered, e.g.,
fqSubset <- fq[dist>4]
A different strategy can be used to tally or eliminate reads that consist
predominantly of a single nucleotide. alphabetFrequency calculates the
frequency of each nucleotide (in DNA strings) or letter (for other string sets)
in each read. Thus one could identify and eliminate reads with more than 30
adenine nucleotides with
countA <- alphabetFrequency(sread(fq))[,"A"]
fqNoPolyA <- fq[countA < 30]
alphabetFrequency, which simply counts nucleotides, is much faster than
srdistance, which performs full pairwise alignment of each read to the
subject.
Users wanting to use R for whole-genome alignments or more flexible pairwise
alignment are encouraged to investigate the Biostrings and
pwalign packages, especially the PDict class and matchPDict
and pairwiseAlignment functions.
The ShortRead package contains functions and classes to support early file formats and ungapped alignments. Help pages are flagged as ‘legacy’; versions of ShortRead prior to 1.21 (Bioconductor version 2.13) contains a vignette illustrating common workflows with these file formats.
sessionInfo()
## R version 4.6.0 RC (2026-04-17 r89917)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /home/biocbuild/bbs-3.24-bioc/R/lib/libRblas.so
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.12.0 LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_GB LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: America/New_York
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] ShortRead_1.71.0 GenomicAlignments_1.49.0
## [3] SummarizedExperiment_1.43.0 Biobase_2.73.0
## [5] MatrixGenerics_1.25.0 matrixStats_1.5.0
## [7] Rsamtools_2.29.0 GenomicRanges_1.65.0
## [9] Biostrings_2.81.0 Seqinfo_1.3.0
## [11] XVector_0.53.0 IRanges_2.47.0
## [13] S4Vectors_0.51.0 BiocParallel_1.47.0
## [15] BiocGenerics_0.59.0 generics_0.1.4
## [17] BiocStyle_2.41.0
##
## loaded via a namespace (and not attached):
## [1] sass_0.4.10 SparseArray_1.13.0 bitops_1.0-9
## [4] jpeg_0.1-11 lattice_0.22-9 digest_0.6.39
## [7] RColorBrewer_1.1-3 evaluate_1.0.5 grid_4.6.0
## [10] bookdown_0.46 fastmap_1.2.0 jsonlite_2.0.0
## [13] Matrix_1.7-5 cigarillo_1.3.0 BiocManager_1.30.27
## [16] codetools_0.2-20 jquerylib_0.1.4 abind_1.4-8
## [19] cli_3.6.6 rlang_1.2.0 crayon_1.5.3
## [22] cachem_1.1.0 DelayedArray_0.39.0 yaml_2.3.12
## [25] otel_0.2.0 S4Arrays_1.13.0 tools_4.6.0
## [28] parallel_4.6.0 deldir_2.0-4 interp_1.1-6
## [31] hwriter_1.3.2.1 png_0.1-9 R6_2.6.1
## [34] lifecycle_1.0.5 pwalign_1.9.0 bslib_0.10.0
## [37] Rcpp_1.1.1-1.1 xfun_0.57 knitr_1.51
## [40] latticeExtra_0.6-31 htmltools_0.5.9 rmarkdown_2.31
## [43] compiler_4.6.0